Product Description
For more info on customized DNA models such as these, check out my shop 3D DNA Molecule Models at https://www.shapeways.com/shops/molecule_models
These two models encode DNA sequences ATCAACAGCACCATCACCGTGACCGAG and TGGCACATCACCGAGCACGAGGCCGAC, as requested by customer.
These models are according to regular option "Large, Horizontal".
When ordering two models at once like this I can give a reduction of $10,= on the order.
